| Aliases | hsa_circ_0001564 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr5:179132679-179137066:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000127022.10 | ||||
| Gene Name | CANX | Detection pipeline | . | ||||
| Sample Type | cd_34; Hs68_RNase; Hs68_control; K562; Helas3; H1hesc; Gm12878 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_51378 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr5:179132679-179137066 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | PA1;HeLa_S3;Parietal;Liver_T3;Liver_N6;Liver_N14;Liver;Liver_T13;Liver_T8;Diencephalon;Liver_N7;NHEK;Liver_N11;Cortex;Forebrain;Liver_T6;Occipital;Temporal;Liver_T7;HUVEC;H9;Liver_T12;A549;Lung;Liver_T15;SH-SY5Y_D0_exp2;Liver_N12;Liver_N15;Stomach;Liver_N13;Liver_N8;H1;SH-SY5Y_D2_exp1;Liver_N10;GM12878;Liver_T10;Cerebellum;SH-SY5Y_D8_exp2;Liver_T14;Liver_N3;Thyroid;Heart;AG04450;Liver_T11;K562;Hs68;Liver_T22;Liver_N21;Liver_T21;Liver_N17;Liver_N22;Liver_T19;Liver_N19;Liver_T17;Liver_T18;Liver_N18;Liver_N20 | ||||||||
| Method for Estimation | poly(A)-;Ribo-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_003156 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr5:179132679-179137066:+ | ||||
| CircRNA type | n/a | Gene ID | ENSG00000127022.10 | ||||
| Gene Name | CANX | Detection pipeline | Find_circ | ||||
| Sample Type | colorectal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_104030 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr5:179132679-179137066:+ | ||||
| CircRNA type | exonic | Gene ID | ENSG00000127022.10 | ||||
| Gene Name | CANX | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0001564 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr5:179132679-179137066:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000127022.10 | ||||
| Gene Name | CANX | Detection pipeline | N/A | ||||
| Sample Type | Osteosarcoma | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | CATCCTTTGCGCTCAGAGGA | ||||||||
| Reverse Primer | GATTGGCCTGACCACAGTCTA | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |