Aliases hsa_circ_0001566 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr5:179688683-179707608:-
CircRNA type . Gene ID ENSG00000050748.13
Gene Name MAPK9 Detection pipeline .
Sample Type cd_19; Hs68_RNase; Hs68_control; K562; Huvec; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Nhek; Sknshra; Mcf7
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_51436 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr5:179688683-179707608
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Liver_N13;HepG2;Liver_T8;Liver_T10;PA1;Liver_T12;Liver_N10;Diencephalon;Liver_T7;Liver_T6;Liver_N14;HUVEC;Liver_N7;SH-SY5Y_D0_exp1;Cerebellum;SH-SY5Y_D4_exp1;NHEK;Liver_N11;Cortex;SH-SY5Y_D2_exp1;Liver_N3;Parietal;Liver_T13;K562;Liver_N15;Liver_N12;Thyroid;HeLa_S3;SH-SY5Y_D8_exp2;GM12878;Liver_T14;Liver_T3;Liver;H9;A549;Kidney;Liver_T15;Liver_T11;Stomach;Temporal;Heart;AG04450;Occipital;Liver_N6;SH-SY5Y_D0_exp2;H1;Forebrain;SH-SY5Y_D4_exp2;Lung;BJ;Liver_N8;Hs68;Liver_T22;Liver_T17;Liver_T21;Liver_T20;Liver_N17;Liver_N22;Liver_N19;Liver_T19;Liver_N21;Liver_N20;Liver_N18;Liver_T18
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases circ_008860 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr5:179688683-179707608:-
CircRNA type n/a Gene ID ENSG00000050748.13
Gene Name MAPK9 Detection pipeline Find_circ
Sample Type colorectal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25624062
Aliases chr5:179688683-179707608 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr5:179688683-179707608:n/a
CircRNA type n/a Gene ID ENSG00000050748.13
Gene Name MAPK9 Detection pipeline UROBORUS
Sample Type gliomas
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 26873924
Aliases hsa_circRNA_104036 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr5:179688683-179707608:-
CircRNA type exonic Gene ID ENSG00000050748.13
Gene Name MAPK9 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases chr18:107887-108499 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr5:179688683-179707608:-
CircRNA type N/A Gene ID ENSG00000050748.13
Gene Name MAPK9 Detection pipeline N/A
Sample Type Gliomas
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer GCCCCTTTAGGCAGAGCTTA
Reverse Primer CTACAGGGGGCTTGTGACAT
Pubmed 28236760
Aliases hsa_circ_0001566 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr5:179688683-179707608:-
CircRNA type N/A Gene ID ENSG00000050748.13
Gene Name MAPK9 Detection pipeline N/A
Sample Type Gliomas
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer CTTTGTGGTATTAAACATCTGC
Reverse Primer TCACATTTACTGTCGCTCA
Pubmed 28236760
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size