| Aliases | hsa_circ_0072088 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr5:32379220-32388780:- | ||||
| CircRNA type | . | Gene ID | ENSG00000056097.15 | ||||
| Gene Name | ZFR | Detection pipeline | . | ||||
| Sample Type | Hepg2; Helas3; H1hesc; Gm12878; Bj; A549; Nhek; Sknshra | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_51574 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr5:32379220-32388780 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | H1;Liver_T14;Parietal;PA1;SH-SY5Y_D0_exp1;Heart;Temporal;Liver_T8;Liver_T15;Diencephalon;NHEK;Liver_N15;Liver_N7;HeLa_S3;Liver_N3;Occipital;Hs68;Liver_T18;Liver_N17;Liver_N19;Liver_T21 | ||||||||
| Method for Estimation | poly(A)-;Ribo-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_103809 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr5:32379220-32388780:- | ||||
| CircRNA type | exonic | Gene ID | ENSG00000056097.15 | ||||
| Gene Name | ZFR | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circZFR/hsa_circ_0072088 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr5:32379220-32388780:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000056097.15 | ||||
| Gene Name | ZFR | Detection pipeline | N/A | ||||
| Sample Type | Bladder cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | GATTATCATACGCATTCTTCG | ||||||||
| Reverse Primer | TTTCTGAACTGCCTGTAACTC | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |