Aliases hsa_circ_0007915 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr5:61745753-61747760:+
CircRNA type . Gene ID ENSG00000086200.12;ENSG00000068796.12
Gene Name IPO11;KIF2A Detection pipeline .
Sample Type Hs68_RNase; Hs68_control; K562; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Nhek; Sknshra; Mcf7
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_52101 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr5:61745753-61747760
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Stomach;Forebrain;HepG2;Lung;Liver_N3;Liver_T12;Occipital;SH-SY5Y_D4_exp1;H9;BJ;Liver_T11;Liver;Diencephalon;Liver_N13;Liver_T13;SH-SY5Y_D0_exp1;PA1;Parietal;HeLa_S3;Temporal;GM12878;Heart;K562;NHEK;Liver_N6;SH-SY5Y_D2_exp1;Liver_N11;Liver_N15;Liver_T10;Liver_N14;Liver_T14;Cortex;H1;AG04450;Cerebellum;A549;Liver_N12;Liver_N10;SH-SY5Y_D4_exp2;Hs68;Liver_N17;Liver_T17;Liver_N19;Liver_N22;Liver_N21;Liver_N20;Liver_T20;Liver_T19;Liver_T22;Liver_T21
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases circIPO11/hsa_circRNA_103847/hsa_circ_0007915 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr5:61745753-61747760:+
CircRNA type N/A Gene ID ENSG00000086200.12;ENSG00000068796.12
Gene Name IPO11;KIF2A Detection pipeline N/A
Sample Type Liver cell carcinoma
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer CCAGACAGTGGCCTGAACTAA
Reverse Primer AGTTGGTGATGAGCCCTGC
Pubmed 28727484
Aliases hsa_circ_0000615/MICRA Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr5:61745753-61747760:+
CircRNA type N/A Gene ID ENSG00000086200.12;ENSG00000068796.12
Gene Name IPO11;KIF2A Detection pipeline N/A
Sample Type Myocardial infarction
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer GCTAAAGAAAGTCAAGTC
Reverse Primer TCAAGGACATCTTAGAGT
Pubmed 29159270
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size