| Aliases | hsa_circ_0007158 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr5:74109664-74137504:- | ||||
| CircRNA type | . | Gene ID | ENSG00000198780.7 | ||||
| Gene Name | FAM169A | Detection pipeline | . | ||||
| Sample Type | Hs68_RNase; Hs68_control; Hepg2; Helas3; H1hesc; Gm12878; A549; Nhek | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_52581 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr5:74109664-74137504 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | H9;Cortex;Forebrain;Liver;PA1;Liver_N14;Liver_T11;Liver_N7;Liver_N8;A549;Liver_T14;Liver_N15;Occipital;Liver_N11;NHEK;SH-SY5Y_D4_exp2;Temporal;Parietal;Liver_T3;Liver_N6;Liver_T7;Liver_N3;Liver_N13;Liver_T15;Liver_T6;Cerebellum;Diencephalon;SH-SY5Y_D2_exp1;Liver_T12;H1;Liver_N10;Liver_T10;HeLa_S3;GM12878;Liver_T13;SH-SY5Y_D4_exp1;Liver_N12;HepG2;Hs68;Liver_N18;Liver_N17;Liver_T20;Liver_N20;Liver_T17;Liver_N22;Liver_T21;Liver_T19;Liver_N19 | ||||||||
| Method for Estimation | Ribo-;poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_103890 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr5:74109664-74137504:- | ||||
| CircRNA type | exonic | Gene ID | ENSG00000198780.7 | ||||
| Gene Name | FAM169A | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circFAM169A/hsa_circ_0007158 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr5:74109664-74137504:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000198780.7 | ||||
| Gene Name | FAM169A | Detection pipeline | N/A | ||||
| Sample Type | Bladder cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | GAGGTAAAGATTTTGGGCTTCACA | ||||||||
| Reverse Primer | GGATTTTCAGGGTCCCCACA | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |