| Aliases | hsa_circ_0002260 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr5:78936673-78964851:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000164329.9 | ||||
| Gene Name | PAPD4 | Detection pipeline | . | ||||
| Sample Type | Hs68_RNase; Hs68_control; K562; Hepg2; Bj | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_52749 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr5:78936673-78964851 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Liver_T3;Liver_N15;PA1;H9;Liver_N6;SH-SY5Y_D0_exp1;Liver_T13;Forebrain;Diencephalon;K562;Thyroid;Liver_N8;SH-SY5Y_D0_exp2;Liver_N7;Liver;Temporal;SH-SY5Y_D8_exp2;GM12878;BJ;Liver_N12;Liver_T11;Liver_N10;Cerebellum;Liver_T6;Parietal;H1;Liver_T8;Occipital;SH-SY5Y_D4_exp1;Liver_T10;Heart;Liver_T14;Cortex;Liver_T15;NHEK;Lung;Stomach;HepG2;Liver_N13;Liver_T7;Liver_T12;Liver_N11;Liver_N14;Hs68;Liver_N17;Liver_N21;Liver_N20;Liver_T21;Liver_T18;Liver_N22;Liver_T22;Liver_N19;Liver_T20;Liver_N18;Liver_T17 | ||||||||
| Method for Estimation | Ribo-;RNaseR;poly(A)- | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_008754 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr5:78936673-78964851:+ | ||||
| CircRNA type | n/a | Gene ID | ENSG00000164329.9 | ||||
| Gene Name | PAPD4 | Detection pipeline | Find_circ | ||||
| Sample Type | colorectal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0002260 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr5:78936673-78964851:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000164329.9 | ||||
| Gene Name | PAPD4 | Detection pipeline | N/A | ||||
| Sample Type | Hypopharyngeal Squamous Cell Carcinoma | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | ATCAAACCTTGGGGACCTCT | ||||||||
| Reverse Primer | AAAGAGGACCCAACCAAAAA | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |