Aliases hsa_circ_0004712 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr6:136468488-136476896:+
CircRNA type . Gene ID ENSG00000171408.9;ENSG00000237596.2
Gene Name PDE7B;RP13-143G15.4 Detection pipeline .
Sample Type Hs68_RNase; Hs68_control; Huvec; Hepg2; Ag04450; Sknshra
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases HSA_CIRCpedia_53645 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr6:136468488-136476896
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Stomach;Liver;Cerebellum;Liver_N14;Liver_N3;Liver_N7;AG04450;Liver_N15;Liver_N13;Liver_N11;Diencephalon;Parietal;Thyroid;Heart;Hs68;Liver_N21;Liver_N22;Liver_T21;Liver_N20
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_003318 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr6:136468488-136476896:+
CircRNA type n/a Gene ID ENSG00000171408.9;ENSG00000237596.2
Gene Name PDE7B;RP13-143G15.4 Detection pipeline Find_circ
Sample Type colorectal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases hsa_circRNA_104194 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr6:136468488-136476896:+
CircRNA type exonic Gene ID ENSG00000171408.9;ENSG00000237596.2
Gene Name PDE7B;RP13-143G15.4 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases hsa_circ_0004712 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr6:136468488-136476896:+
CircRNA type N/A Gene ID ENSG00000171408.9;ENSG00000237596.2
Gene Name PDE7B;RP13-143G15.4 Detection pipeline N/A
Sample Type Rheumatoid Arthritis
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer GATAAAAACTAACCACCATCTTGC
Reverse Primer AAGGTAGTCTTCATCCAGCAGG
Aliases circ_0004712/hsa_circ_0004712 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr6:136468488-136476896:+
CircRNA type N/A Gene ID ENSG00000171408.9;ENSG00000237596.2
Gene Name PDE7B;RP13-143G15.4 Detection pipeline N/A
Sample Type Ovarian endometriosis
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer AGGGGTGAACCAGCCATTT
Reverse Primer GCCAATCTCCCTGAGTATGTT
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size