Aliases hsa_circ_0002198 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr6:136472297-136476896:+
CircRNA type . Gene ID ENSG00000171408.9;ENSG00000237596.2
Gene Name PDE7B;RP13-143G15.4 Detection pipeline .
Sample Type Hs68_RNase; Hs68_control; Hepg2; Helas3; Bj; Ag04450; A549; Sknshra
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases HSA_CIRCpedia_53646 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr6:136472297-136476896
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Cortex;Liver_N15;HeLa_S3;BJ;Stomach;AG04450;Liver_T11;Parietal;Diencephalon;Liver_T12;Liver_N3;A549;Occipital;SH-SY5Y_D8_exp2;Liver_T8;HepG2;Liver_N7;Temporal;Liver_N14;Liver_N8;Liver_N12;SH-SY5Y_D0_exp2;Liver_N11;Thyroid;Liver_N6;Hs68;Liver_N17;Liver_N22;Liver_N21;Liver_N20;Liver_T19;Liver_N19;Liver_T17;Liver_T20
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001568 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr6:136472297-136476896:+
CircRNA type n/a Gene ID ENSG00000171408.9;ENSG00000237596.2
Gene Name PDE7B;RP13-143G15.4 Detection pipeline Find_circ
Sample Type colorectal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_0002198/hsa_circ_0002198 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr6:136472297-136476896:+
CircRNA type N/A Gene ID ENSG00000171408.9;ENSG00000237596.2
Gene Name PDE7B;RP13-143G15.4 Detection pipeline N/A
Sample Type Ovarian endometriosis
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer GCAAACCTATATCAGGAAACAGC
Reverse Primer TTGAAGAGGTGGCACAACAGT
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size