Aliases hsa_circ_0078768 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr6:170626457-170632347:+
CircRNA type . Gene ID ENSG00000112584.9
Gene Name FAM120B Detection pipeline .
Sample Type K562; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Nhek; Sknshra; Mcf7
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_54432 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr6:170626457-170632347
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Liver_T13;Liver_N3;A549;Temporal;SH-SY5Y_D0_exp1;Liver_T6;AG04450;Kidney;Liver_T14;Liver_T10;PA1;Liver_T8;NHEK;H1;SK_N_SH;Liver_T15;Diencephalon;Cerebellum;SH-SY5Y_D4_exp2;K562;HepG2;Cortex;BJ;Parietal;GM12878;SH-SY5Y_D2_exp1;HeLa_S3;Forebrain;Liver_N13;HUVEC;Liver_T12;Liver_T7;Liver_N12;Occipital;Hs68;Liver_N22;Liver_T21;Liver_T17;Liver_T22;Liver_N19;Liver_N17;Liver_N21;Liver_N20
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases hsa_circRNA_104269 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr6:170626457-170632347:+
CircRNA type exonic Gene ID ENSG00000112584.9
Gene Name FAM120B Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases hsa_circ_0078768 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr6:170626457-170632347:+
CircRNA type N/A Gene ID ENSG00000112584.9
Gene Name FAM120B Detection pipeline N/A
Sample Type Active Pulmonary Tuberculosis
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer AGAAGATGAGCTTGACCAGG
Reverse Primer ACCTCTCACACCCATAACTG
Pubmed 28846924
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size