| Aliases | hsa_circ_0075829 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr6:22020567-22056919:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000272168.6 | ||||
| Gene Name | CASC15 | Detection pipeline | . | ||||
| Sample Type | H1hesc; Ag04450; Sknshra | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_54611 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr6:22020567-22056919 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | PA1;H9;SH-SY5Y_D2_exp1;H1;Liver_T14;SH-SY5Y_D4_exp2;Kidney;Forebrain;AG04450;SK_N_SH;Parietal;SH-SY5Y_D0_exp1;Liver_T11;Cerebellum;Diencephalon;Temporal;Cortex;Liver_N3;Occipital;SH-SY5Y_D0_exp2;Liver_T21 | ||||||||
| Method for Estimation | poly(A)-;RNaseR;Ribo- | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_104084 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr6:22020567-22056919:+ | ||||
| CircRNA type | exonic | Gene ID | ENSG00000272168.6 | ||||
| Gene Name | CASC15 | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0075829 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr6:22020567-22056919:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000272168.6 | ||||
| Gene Name | CASC15 | Detection pipeline | N/A | ||||
| Sample Type | Basal cell carcinoma | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | GAGCTGTGGAGTCCAAGTGTG | ||||||||
| Reverse Primer | TTGAGAAGGATGTTCAGTAGTAACC | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |