Aliases hsa_circ_0007874 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr6:74175931-74176329:+
CircRNA type . Gene ID ENSG00000135297.11
Gene Name MTO1 Detection pipeline .
Sample Type Hs68_RNase; Hs68_control; K562; Huvec; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Nhek
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_55478 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr6:74175931-74176329
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Liver_N15;Liver_N11;Liver_N6;Liver_T3;Liver_N10;AG04450;Liver_T12;Liver;Lung;PA1;Liver_N8;Liver_T6;SH-SY5Y_D4_exp1;Diencephalon;Thyroid;Heart;Liver_T13;Occipital;Liver_N7;GM12878;SK_N_SH;Liver_T10;K562;Temporal;Liver_N13;Liver_N14;HUVEC;HepG2;Cortex;Liver_T8;A549;BJ;Stomach;HeLa_S3;Liver_N3;Forebrain;Liver_T14;Liver_T11;Cerebellum;Parietal;H9;Liver_T7;Liver_T15;Liver_N12;Hs68;Liver_T20;Liver_T18;Liver_N21;Liver_N17;Liver_N19;Liver_T21;Liver_N18;Liver_N22;Liver_T17
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases hsa_circRNA_104135 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr6:74175931-74176329:+
CircRNA type exonic Gene ID ENSG00000135297.11
Gene Name MTO1 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases circMTO1/hsa_circRNA_0007874/hsa_circRNA_104135 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr6:74175931-74176329:+
CircRNA type N/A Gene ID ENSG00000135297.11
Gene Name MTO1 Detection pipeline N/A
Sample Type Liver cell carcinoma
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer TGCATCAGAGGCTTGGAGAA
Reverse Primer AAGGAAGGGGTGATCTGACG
Pubmed 28520103
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size