| Aliases | hsa_circ_0014130 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:151206672-151212515:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000143398.19 | ||||
| Gene Name | PIP5K1A | Detection pipeline | . | ||||
| Sample Type | Nhek; Helas3; Gm12878 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_27934 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:151206672-151212515 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Cerebellum;Liver;GM12878;Parietal;Cortex;Occipital;Liver_T15;Hs68 | ||||||||
| Method for Estimation | Ribo-;poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_100332 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:151206672-151212515:+ | ||||
| CircRNA type | exonic | Gene ID | ENSG00000143398.19 | ||||
| Gene Name | PIP5K1A | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0014130 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:151206672-151212515:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000143398.19 | ||||
| Gene Name | PIP5K1A | Detection pipeline | N/A | ||||
| Sample Type | Non small cell Lung Cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | AGATTCCCTAACCTCAACCAGA | ||||||||
| Reverse Primer | CGAATGTTCTTGCCACCTGC | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |