Aliases HSA_CIRCpedia_56610 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Occipital
Method for Estimation RNaseR;poly(A)-;Ribo-
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases chr7|129205202-129206587 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr7:129205202-129206587:n/a
CircRNA type circRNA Gene ID NA
Gene Name NA Detection pipeline CIRCexplorer2
Sample Type PDLSC osteogenis
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_005680 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type ERR1161588
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_005552 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type ERR1161589
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_005656 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type ERR1161590
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_005362 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type ERR1161591
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_005172 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type ERR1161592
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_005562 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type ERR1161593
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000124 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type ERR688856
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002695 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type ERR688857
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_013601 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR867813
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002486 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1643167
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002410 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1643168
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002437 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1643169
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002409 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1643170
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002581 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1643171
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002567 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1643172
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002519 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1643173
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002556 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1643174
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002064 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1643175
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002011 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1643176
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002027 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1643177
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000729 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1643178
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002473 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1643179
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002531 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1643180
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002519 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1643181
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002491 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1643182
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000349 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1643183
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000356 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1643185
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000344 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1643186
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002098 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1643187
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002165 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1643189
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002063 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1643190
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_003500 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1643191
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_003463 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1643192
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_003362 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1643193
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_003339 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1643194
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_003629 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1643195
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002995 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1643197
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002912 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1643198
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_003697 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1643199
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_003701 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1643200
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000251 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1643201
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000256 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1643202
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002985 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1643203
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002993 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1643204
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000003 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1643262
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000002 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1643277
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000180 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1643326
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000167 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1362711
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001360 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1363005
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000348 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1363080
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_013379 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1363096
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_007794 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1363098
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_014049 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1363099
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_009818 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1363100
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002392 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1538596
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000315 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1538597
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_007797 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1538598
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_004332 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1538599
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_004793 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1600265
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_013013 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR1600267
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000369 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2125671
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_005189 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2131505
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_008007 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2131506
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_012723 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2131507
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_007017 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2131508
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_004126 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2131509
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002382 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2131510
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_004538 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2131511
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001497 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2131512
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_005190 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2131514
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_006348 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2131515
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002196 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2131516
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_007496 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2131517
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002313 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2131518
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002233 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2131519
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002644 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2131520
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_008450 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2131521
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_003077 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2131522
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_015227 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2131523
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_013176 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2131524
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_007677 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2131525
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_003080 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2131526
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002762 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2131527
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_008579 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2131528
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_007791 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2131529
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_005630 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2131531
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002174 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2131532
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_016321 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2131533
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_007028 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2131535
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002686 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2131536
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_007635 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2131537
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_006804 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2131538
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_006972 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2131540
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_009031 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2131541
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_011436 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2131542
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_010967 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2131543
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_008992 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2131544
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_008900 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2131545
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_007616 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2131546
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000042 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2759122
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000028 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2759125
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002257 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR3084933
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_006507 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR3084934
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_005014 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR3084935
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_004824 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR3084936
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_005088 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR3084937
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_005702 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR3084938
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_005737 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR3084939
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_005821 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR3084940
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_003866 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR3084941
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_005333 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR3084942
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_004313 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR3084943
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_005362 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR3084945
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_005795 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR3084946
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_004398 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR3084947
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_006288 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR3084948
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_004949 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR3084949
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_005489 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR3084950
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_007949 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR3084952
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_005804 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR3084953
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_005796 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR3084954
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_005529 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR3084956
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_004539 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR3084957
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_008792 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR3084958
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_005301 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR3084959
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_004295 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR3084960
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_005254 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR3084961
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_004759 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR3084962
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_001867 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2537178
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000810 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2537210
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002239 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2537219
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002143 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2537220
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000360 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2537232
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000280 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2537233
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002043 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2537242
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000367 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2537245
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000165 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type . Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline .
Sample Type SRR2537249
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases test_circ_001423 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type 0 Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline FindCirc
Sample Type SS
Method for Estimation RNA-seq
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer 0
Reverse Primer 0
Aliases test_circ_002523 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type 0 Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline FindCirc
Sample Type SS
Method for Estimation RNA-seq
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer 0
Reverse Primer 0
Aliases test_circ_001180 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type 0 Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline FindCirc
Sample Type SS
Method for Estimation RNA-seq
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer 0
Reverse Primer 0
Aliases test_circ_001180 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type 0 Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline FindCirc
Sample Type SS
Method for Estimation RNA-seq
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer 0
Reverse Primer 0
Aliases test_circ_002656 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type 0 Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline FindCirc
Sample Type CC
Method for Estimation RNA-seq
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer 0
Reverse Primer 0
Aliases circRNA SMO Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr7:129205202-129206587:+
CircRNA type N/A Gene ID ENSG00000128602.9;NM_005631
Gene Name SMO;SMO Detection pipeline N/A
Sample Type PDLSC osteogenis
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer ATCGTGGGAGGCTACTTCCT
Reverse Primer ACTGGCCTGAACTGTTGAACT
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size