| Aliases | hsa_circ_0082582 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr7:138203933-138255748:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000122779.12 | ||||
| Gene Name | TRIM24 | Detection pipeline | . | ||||
| Sample Type | K562; H1hesc | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_56900 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr7:138203933-138255748 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | H1 | ||||||||
| Method for Estimation | poly(A)- | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_104503 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr7:138203933-138255748:+ | ||||
| CircRNA type | exonic | Gene ID | ENSG00000122779.12 | ||||
| Gene Name | TRIM24 | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circTRIM24/hsa_circ_0082582 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr7:138203933-138255748:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000122779.12 | ||||
| Gene Name | TRIM24 | Detection pipeline | N/A | ||||
| Sample Type | Bladder cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | GGATATGATGGAAAGGCTTTTG | ||||||||
| Reverse Primer | AAACACTGGTCGCTGGCTG | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |