Aliases hsa_circ_0006460 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr7:140476711-140494267:-
CircRNA type . Gene ID ENSG00000133606.10
Gene Name MKRN1 Detection pipeline .
Sample Type Hs68_RNase; Hs68_control
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases HSA_CIRCpedia_57081 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr7:140476711-140494267
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Thyroid;AG04450;PA1;Liver_T15;SH-SY5Y_D2_exp1;SH-SY5Y_D8_exp2;Liver_T14;H1;Liver_T10;H9;Stomach;Liver_N12;Heart;SH-SY5Y_D0_exp1;Liver;Liver_N8;BJ;Cortex;Kidney;SH-SY5Y_D4_exp1;A549;Temporal;Liver_T3;Diencephalon;Liver_N15;Liver_N11;Forebrain;HepG2;HeLa_S3;Parietal;Liver_N7;Liver_N6;K562;Liver_T7;Liver_T6;Liver_T11;Liver_N3;GM12878;Liver_N14;Occipital;Cerebellum;Liver_T12;Hs68;Liver_N18;Liver_N17;Liver_T18;Liver_T20;Liver_N19;Liver_N22;Liver_N21;Liver_T21;Liver_T22
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circBRAF/hsa_circ_0006460 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr7:140476711-140494267:-
CircRNA type N/A Gene ID ENSG00000133606.10
Gene Name MKRN1 Detection pipeline N/A
Sample Type Gliomas
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer CTCCAGCTTGTATCACCAT
Reverse Primer TCTTCATCTGCTGGTCGGAA
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size