| Aliases | hsa_circ_0079929 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr7:40027197-40027857:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000065883.15 | ||||
| Gene Name | CDK13 | Detection pipeline | . | ||||
| Sample Type | K562; Huvec; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Sknshra | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_58024 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr7:40027197-40027857 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | HUVEC;SH-SY5Y_D0_exp2;Temporal;SH-SY5Y_D4_exp1;Liver_T14;Kidney;Liver_N14;Diencephalon;Liver_T10;Cortex;Liver_T8;SH-SY5Y_D2_exp1;Liver_T13;Liver_N7;Liver_T3;Thyroid;Heart;Liver_N10;Liver_N15;Liver_T6;Liver_N13;Liver_T15;Liver_T7;H1;SH-SY5Y_D8_exp2;Liver_N3;GM12878;Occipital;SH-SY5Y_D0_exp1;AG04450;HeLa_S3;Liver_T11;Liver_N6;Parietal;Liver_N12;Stomach;BJ;Cerebellum;Liver_N11;A549;Liver_N8;Liver;HepG2;K562;SH-SY5Y_D4_exp2;NHEK;Liver_T12;Hs68;Liver_T21;Liver_T17;Liver_N18;Liver_T19;Liver_N20;Liver_T20;Liver_N22;Liver_N19;Liver_N17;Liver_T22;Liver_N21 | ||||||||
| Method for Estimation | poly(A)-;Ribo-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_002066 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr7:40027197-40027857:+ | ||||
| CircRNA type | n/a | Gene ID | ENSG00000065883.15 | ||||
| Gene Name | CDK13 | Detection pipeline | Find_circ | ||||
| Sample Type | colorectal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_104349 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr7:40027197-40027857:+ | ||||
| CircRNA type | exonic | Gene ID | ENSG00000065883.15 | ||||
| Gene Name | CDK13 | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_104349/hsa_circ_0079929 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr7:40027197-40027857:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000065883.15 | ||||
| Gene Name | CDK13 | Detection pipeline | N/A | ||||
| Sample Type | Thoracic Aortic Dissection | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | CCTGCTACGAGATCTTGAATGC | ||||||||
| Reverse Primer | ACCAAGCATAGGAGCCAAGG | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |