| Aliases | hsa_circ_0080210 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr7:50737418-50773020:- | ||||
| CircRNA type | . | Gene ID | ENSG00000106070.18 | ||||
| Gene Name | GRB10 | Detection pipeline | . | ||||
| Sample Type | K562; Hsmm; H1hesc; Bj; Ag04450; A549 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_58233 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr7:50737418-50773020 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Liver_T11;AG04450;K562;A549;Occipital;Diencephalon;BJ;Liver_T8;Temporal;Liver_N7;Liver_N3;PA1;Liver_T15;Liver_T7;Thyroid;H9;Liver_T14;Liver_N8;Liver_N6;Kidney;Cerebellum;Parietal;Forebrain;Cortex;H1;HeLa_S3;Liver;Liver_N15;Liver_N11;Hs68;Liver_N18;Liver_N19;Liver_N17;Liver_N22 | ||||||||
| Method for Estimation | Ribo-;poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_104374 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr7:50737418-50773020:- | ||||
| CircRNA type | exonic | Gene ID | ENSG00000106070.18 | ||||
| Gene Name | GRB10 | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0080210/circ-GRB10 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr7:50737418-50773020:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000106070.18 | ||||
| Gene Name | GRB10 | Detection pipeline | N/A | ||||
| Sample Type | Intervertebral disc degeneration | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | GCCGCCGCAAAGCAGATATTC | ||||||||
| Reverse Primer | ACAGACTCCAGCAGGGTCAG | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |