Aliases hsa_circ_0079385 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr7:6624646-6624891:+
CircRNA type . Gene ID ENSG00000232581.1;ENSG00000136247.10
Gene Name AC079742.4;ZDHHC4 Detection pipeline .
Sample Type Nhek; K562; Huvec; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Sknshra; Mcf7
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_58571 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr7:6624646-6624891
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Forebrain;Temporal;BJ;Liver_T10;Liver_N10;AG04450;SH-SY5Y_D8_exp2;Liver_N13;Heart;PA1;Liver_T7;NHEK;Liver_T15;H1;SH-SY5Y_D2_exp1;Liver;Thyroid;Lung;Liver_N6;Liver_N3;Liver_T11;Liver_T14;A549;Cortex;Liver_N14;Liver_N15;SH-SY5Y_D0_exp1;GM12878;HeLa_S3;Liver_T8;Cerebellum;HUVEC;HepG2;Occipital;H9;Liver_T13;Diencephalon;Parietal;K562;Liver_N12;Liver_N7;Liver_T12;Hs68;Liver_N18;Liver_T20;Liver_T17;Liver_T22;Liver_N19;Liver_T21;Liver_T19;Liver_N17;Liver_N22
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases hsa_circRNA_104310 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr7:6624646-6624891:+
CircRNA type exonic Gene ID ENSG00000232581.1;ENSG00000136247.10
Gene Name AC079742.4;ZDHHC4 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases hsa_circRNA_104310/hsa_circ_0079385 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr7:6624646-6624891:+
CircRNA type N/A Gene ID ENSG00000232581.1;ENSG00000136247.10
Gene Name AC079742.4;ZDHHC4 Detection pipeline N/A
Sample Type Infantile Hemangioma (IH)
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer GGACACGGTCTTTCTTATTCAGG
Reverse Primer ACAGTGATGGTCGAAACGGTG
Pubmed 29095957
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size