Aliases hsa_circ_0001727 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr7:99621041-99621930:+
CircRNA type . Gene ID ENSG00000197037.10
Gene Name ZSCAN25 Detection pipeline .
Sample Type HEK293; cd_19; cd_34; Hs68_RNase; Hs68_control; Nhek; K562; Huvec; Hsmm; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Nhlf; Sknshra; Mcf7
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases HSA_CIRCpedia_59516 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr7:99621041-99621930
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Liver;NHEK;Liver_N8;Liver_T10;SH-SY5Y_D4_exp1;Liver_T14;Parietal;Cerebellum;HeLa_S3;Liver_N3;Cortex;AG04450;Temporal;HUVEC;SH-SY5Y_D0_exp1;Liver_T13;SH-SY5Y_D4_exp2;Liver_N10;Liver_N6;Heart;SK_N_SH;SH-SY5Y_D0_exp2;Liver_T8;Liver_T12;PA1;GM12878;SH-SY5Y_D2_exp1;Liver_T3;H9;Liver_T6;Liver_N13;BJ;Liver_N15;Liver_N12;Liver_T7;SH-SY5Y_D8_exp2;K562;Liver_N7;Thyroid;H1;Occipital;Diencephalon;Kidney;A549;Liver_T15;Liver_N11;Liver_T11;HepG2;Liver_N14;Stomach;Lung;Forebrain;Hs68;Liver_T22;Liver_N21;Liver_N20;Liver_T19;Liver_N22;Liver_N19;Liver_N18;Liver_T20;Liver_N17;Liver_T21;Liver_T18;Liver_T17
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_000152 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr7:99621041-99621930:+
CircRNA type n/a Gene ID ENSG00000197037.10
Gene Name ZSCAN25 Detection pipeline Find_circ
Sample Type colorectal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases chr7:99621041-99621930 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr7:99621041-99621930:n/a
CircRNA type n/a Gene ID ENSG00000106261.12
Gene Name ZKSCAN1 Detection pipeline UROBORUS
Sample Type gliomas
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases hsa_circRNA_104435 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr7:99621041-99621930:+
CircRNA type exonic Gene ID ENSG00000197037.10
Gene Name ZSCAN25 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases hsa_circ_0001727 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr7:99621041-99621930:n/a
CircRNA type n/a Gene ID ENSG00000106261.12
Gene Name ZKSCAN1 Detection pipeline n/a
Sample Type cervical carcinoma
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circZKSCAN1 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr7:99621041-99621930:+
CircRNA type N/A Gene ID ENSG00000197037.10
Gene Name ZSCAN25 Detection pipeline N/A
Sample Type Liver cell carcinoma
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer TGTAATGAGTGCGGGAAGG
Reverse Primer AATCAGGTATGAGTTTCGGTTG
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size