| Aliases | hsa_circ_0085154 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr8:101721360-101721451:- | ||||
| CircRNA type | . | Gene ID | ENSG00000070756.9 | ||||
| Gene Name | PABPC1 | Detection pipeline | . | ||||
| Sample Type | K562; Hepg2; Helas3; Sknshra | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_59650 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr8:101721360-101721451 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | K562 | ||||||||
| Method for Estimation | poly(A)- | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_104665 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr8:101721360-101721451:- | ||||
| CircRNA type | exonic | Gene ID | ENSG00000070756.9 | ||||
| Gene Name | PABPC1 | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0085154 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr8:101721360-101721451:n/a | ||||
| CircRNA type | n/a | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | n/a | ||||
| Sample Type | cervical carcinoma | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | CircARSP91/hsa_circ_0085154 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr8:101721360-101721451:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000070756.9 | ||||
| Gene Name | PABPC1 | Detection pipeline | N/A | ||||
| Sample Type | Liver cell carcinoma | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | GGTGCCAGACCTCATCACTC | ||||||||
| Reverse Primer | GAGCAGTCCAGCGAGGACTT | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |