Aliases hsa_circ_0001824 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr8:131164981-131181313:-
CircRNA type . Gene ID ENSG00000153317.10;ENSG00000212342.1
Gene Name ASAP1;SNORA12 Detection pipeline .
Sample Type cd_19; neutr; Hs68_RNase; Hs68_control; K562; Helas3; Gm12878; Bj; Ag04450; A549; Sknshra
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_60081 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr8:131164981-131181313
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Liver_T14;Liver_N15;Liver_T6;SK_N_SH;Liver_T11;SH-SY5Y_D4_exp2;Liver_N3;SH-SY5Y_D2_exp1;Liver_N6;HeLa_S3;Liver;PA1;K562;A549;Cortex;Forebrain;Stomach;Liver_T7;SH-SY5Y_D0_exp1;Liver_T15;AG04450;Liver_N8;Diencephalon;Liver_N14;Kidney;Parietal;Liver_N13;Liver_T8;Liver_T3;Thyroid;Liver_T13;Heart;SH-SY5Y_D8_exp2;H9;Liver_T12;SH-SY5Y_D4_exp1;Temporal;BJ;Occipital;GM12878;Liver_N12;Liver_N10;NHEK;Cerebellum;Liver_N11;SH-SY5Y_D0_exp2;Liver_N7;Hs68;Liver_T22;Liver_N20;Liver_N21;Liver_T20;Liver_T21;Liver_T17;Liver_T18;Liver_N17;Liver_N18;Liver_T19;Liver_N19;Liver_N22
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases circ_005376 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr8:131164981-131181313:-
CircRNA type n/a Gene ID ENSG00000153317.10;ENSG00000212342.1
Gene Name ASAP1;SNORA12 Detection pipeline Find_circ
Sample Type colorectal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25624062
Aliases hsa_circRNA_104689 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr8:131164981-131181313:-
CircRNA type exonic Gene ID ENSG00000153317.10;ENSG00000212342.1
Gene Name ASAP1;SNORA12 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases hsa_circ_104689/hsa_circ_0001824 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr8:131164981-131181313:-
CircRNA type N/A Gene ID ENSG00000153317.10;ENSG00000212342.1
Gene Name ASAP1;SNORA12 Detection pipeline N/A
Sample Type breast cancer
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer TGGCAGTGAAAAGAAGGGGT
Reverse Primer TGAAAGAAATGTGGCATGTGAGA
Pubmed 28484086
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size