Aliases hsa_circ_0085616 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr8:131370262-131374017:-
CircRNA type . Gene ID ENSG00000153317.10
Gene Name ASAP1 Detection pipeline .
Sample Type Nhek; Huvec; Hsmm; Hepg2; Helas3; H1hesc; Bj; Ag04450; A549; Nhlf; Sknshra
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_60099 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr8:131370262-131374017
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Lung;Thyroid;PA1;SH-SY5Y_D8_exp2;SH-SY5Y_D4_exp2;Temporal;Liver_T12;Cerebellum;Liver_T11;Liver_T8;A549;SH-SY5Y_D4_exp1;SH-SY5Y_D0_exp1;Liver_N6;SK_N_SH;HeLa_S3;Kidney;Liver_T3;Liver;Liver_N7;H9;Liver_N12;Parietal;Liver_T7;AG04450;Cortex;Liver_N10;H1;SH-SY5Y_D0_exp2;HepG2;Stomach;Liver_T15;Liver_T14;Liver_T6;BJ;Diencephalon;Liver_T10;HUVEC;Liver_N14;NHEK;Forebrain;Liver_T13;Liver_N13;Heart;Liver_N8;SH-SY5Y_D2_exp1;Liver_N3;Liver_N11;Occipital;Hs68;Liver_N21;Liver_T19;Liver_T17;Liver_T21;Liver_N17;Liver_N18;Liver_T20;Liver_N19;Liver_T22;Liver_T18;Liver_N20;Liver_N22
Method for Estimation Ribo-;RNaseR;poly(A)-
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases circ_007877 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr8:131370262-131374017:-
CircRNA type n/a Gene ID ENSG00000153317.10
Gene Name ASAP1 Detection pipeline Find_circ
Sample Type colorectal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25624062
Aliases hsa_circRNA_104692 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr8:131370262-131374017:-
CircRNA type exonic Gene ID ENSG00000153317.10
Gene Name ASAP1 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases hsa_circ_0085616 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr8:131370262-131374017:-
CircRNA type N/A Gene ID ENSG00000153317.10
Gene Name ASAP1 Detection pipeline N/A
Sample Type Gastric cancer
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer GACTACAACTCGCCCACCAC
Reverse Primer TCCATTTCTGGGCCATAATC
Pubmed 28974900
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size