Aliases hsa_circ_0005273 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr8:141710989-141716304:-
CircRNA type . Gene ID ENSG00000169398.15
Gene Name PTK2 Detection pipeline .
Sample Type Hs68_RNase; Hs68_control; Nhek; Hepg2; Helas3; H1hesc; Bj; Ag04450; A549; Sknshra
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_60203 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr8:141710989-141716304
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type H9;Parietal;Liver_N15;Liver_T15;Diencephalon;Heart;PA1;Liver_N11;Liver_N8;Temporal;Liver_T8;A549;Cerebellum;NHEK;Lung;HeLa_S3;Forebrain;BJ;Liver_T11;Cortex;Liver_T3;Liver_N14;Liver_T12;Liver_T14;Liver_T7;SH-SY5Y_D4_exp1;Liver;AG04450;Liver_N12;K562;H1;Thyroid;Stomach;SH-SY5Y_D0_exp1;Occipital;Hs68;Liver_T18;Liver_N21;Liver_N22;Liver_N20;Liver_T20;Liver_T19;Liver_N17;Liver_N18;Liver_T22;Liver_T21;Liver_N19;Liver_T17
Method for Estimation Ribo-;RNaseR;poly(A)-
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases circ_005484 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr8:141710989-141716304:-
CircRNA type n/a Gene ID ENSG00000169398.15
Gene Name PTK2 Detection pipeline Find_circ
Sample Type colorectal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25624062
Aliases hsa_circRNA_104700 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr8:141710989-141716304:-
CircRNA type exonic Gene ID ENSG00000169398.15
Gene Name PTK2 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases circPTK2/hsa_circ_0005273 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr8:141710989-141716304:-
CircRNA type N/A Gene ID ENSG00000169398.15
Gene Name PTK2 Detection pipeline N/A
Sample Type Bladder cancer
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer TATTGGACCTGCGAGGGATT
Reverse Primer TGTGAACCAGGGTAGCCAGAA
Pubmed 27484176
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size