| Aliases | hsa_circ_0003171 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr8:141749116-141762415:- | ||||
| CircRNA type | . | Gene ID | ENSG00000169398.15 | ||||
| Gene Name | PTK2 | Detection pipeline | . | ||||
| Sample Type | Hs68_RNase; Hs68_control; K562; H1hesc; Gm12878; Bj; A549; Sknshra | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_60222 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr8:141749116-141762415 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Liver_T8;SH-SY5Y_D2_exp1;Lung;PA1;H9;SH-SY5Y_D4_exp2;Liver_T7;Stomach;SH-SY5Y_D8_exp2;Liver_T15;Diencephalon;SH-SY5Y_D0_exp2;Liver_N12;Occipital;Liver_T6;Liver_N11;Liver_N13;SH-SY5Y_D0_exp1;AG04450;GM12878;Cerebellum;Temporal;Liver_T12;Liver_N15;Liver_N14;HepG2;K562;Liver_T14;Thyroid;Heart;Liver;Parietal;Liver_N8;Cortex;Forebrain;Liver_T11;Liver_N7;H1;Hs68;Liver_T22;Liver_N18;Liver_N19;Liver_T20;Liver_T19;Liver_N21;Liver_N17;Liver_T21;Liver_T17;Liver_N22 | ||||||||
| Method for Estimation | Ribo-;RNaseR;poly(A)- | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | chr8:141749116-141762415 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr8:141749116-141762415:n/a | ||||
| CircRNA type | n/a | Gene ID | ENSG00000169398.15 | ||||
| Gene Name | PTK2 | Detection pipeline | UROBORUS | ||||
| Sample Type | gliomas | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0003171 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr8:141749116-141762415:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000169398.15 | ||||
| Gene Name | PTK2 | Detection pipeline | N/A | ||||
| Sample Type | Primary Great Saphenous Vein Varicosities | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | CCCCAACTTGAATCACACACC | ||||||||
| Reverse Primer | ACTGAGGCGGAATCCATAGC | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |