| Aliases | hsa_circ_0008345 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr8:141828375-141874498:- | ||||
| CircRNA type | . | Gene ID | ENSG00000169398.15 | ||||
| Gene Name | PTK2 | Detection pipeline | . | ||||
| Sample Type | Hs68_RNase; Hs68_control | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_60262 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr8:141828375-141874498 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Liver_N12;GM12878;Liver_N11;HeLa_S3;SH-SY5Y_D4_exp1;Liver_T3;HUVEC;A549;Liver_N10;Temporal;Liver_T12;PA1;SH-SY5Y_D2_exp1;SH-SY5Y_D0_exp2;H1;H9;Forebrain;Liver_T7;SK_N_SH;Parietal;Cortex;Liver_T8;Cerebellum;SH-SY5Y_D4_exp2;Liver_T15;Liver_T14;Liver_N13;Liver_T11;Liver_T10;Occipital;Thyroid;Diencephalon;Liver_N14;Liver_N6;Liver_N8;Liver_N3;K562;Liver;Liver_N7;Liver_N15;AG04450;SH-SY5Y_D0_exp1;Lung;Heart;Liver_T13;Stomach;Liver_T6;Hs68;Liver_N17;Liver_T22;Liver_T17;Liver_N21;Liver_N22;Liver_T21;Liver_N18;Liver_T20 | ||||||||
| Method for Estimation | Ribo-;poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | chr8:141828375-141874498 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr8:141828375-141874498:n/a | ||||
| CircRNA type | n/a | Gene ID | ENSG00000169398.15 | ||||
| Gene Name | PTK2 | Detection pipeline | UROBORUS | ||||
| Sample Type | gliomas | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0008345 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr8:141828375-141874498:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000169398.15 | ||||
| Gene Name | PTK2 | Detection pipeline | N/A | ||||
| Sample Type | Gliomas | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | GGCCCAGAAGAAGGAATCAG | ||||||||
| Reverse Primer | GCAATTTCCTGGTCCACTTG | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |