| Aliases | hsa_circ_0002908 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr8:141840570-141874498:- | ||||
| CircRNA type | . | Gene ID | ENSG00000169398.15 | ||||
| Gene Name | PTK2 | Detection pipeline | . | ||||
| Sample Type | Hs68_RNase; Hs68_control | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_60266 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr8:141840570-141874498 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | A549;Liver_N12;Liver_T7;PA1;SH-SY5Y_D8_exp2;SH-SY5Y_D0_exp1;SH-SY5Y_D2_exp1;Heart;H1;Lung;Liver_T3;H9;Liver_N3;GM12878;Liver_N8;Parietal;K562;Liver_N11;Liver_T10;Liver_N15;Liver_T11;Kidney;Liver_T8;Occipital;Liver_T12;Liver_T6;Liver;Temporal;Liver_T14;Diencephalon;Liver_T15;Cortex;Thyroid;Cerebellum;Stomach;Liver_T13;Hs68;Liver_T21;Liver_N20;Liver_N17;Liver_T19;Liver_T22;Liver_T17;Liver_N19 | ||||||||
| Method for Estimation | poly(A)-;Ribo-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0002908 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr8:141840570-141874498:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000169398.15 | ||||
| Gene Name | PTK2 | Detection pipeline | N/A | ||||
| Sample Type | Pulmonary tuberculosis | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | GGGGCAATGCACTAGAAAAG | ||||||||
| Reverse Primer | TCCTTTTGGCAAATAACGAAT | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |