| Aliases | hsa_circ_0003221 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr8:141856358-141900868:- | ||||
| CircRNA type | . | Gene ID | ENSG00000169398.15 | ||||
| Gene Name | PTK2 | Detection pipeline | . | ||||
| Sample Type | Hs68_RNase; Hs68_control; K562; Hsmm; H1hesc; Bj; Ag04450; A549; Sknshra | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_60273 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr8:141856358-141900868 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Liver_N14;Liver_N7;Occipital;AG04450;SH-SY5Y_D0_exp2;SH-SY5Y_D8_exp2;Parietal;Lung;Liver_T15;NHEK;HUVEC;H1;Diencephalon;Liver_T3;Liver_T7;H9;Liver_N10;SH-SY5Y_D4_exp2;PA1;Liver_N3;Liver_N15;Liver_T10;Liver_T11;SH-SY5Y_D2_exp1;Liver_T6;Temporal;Heart;Liver;BJ;Liver_N6;A549;Forebrain;Liver_N11;Thyroid;Liver_T14;K562;Liver_N12;SH-SY5Y_D0_exp1;Liver_N8;HeLa_S3;Liver_N13;Stomach;Liver_T12;Cortex;Cerebellum;Liver_T13;Hs68;Liver_T21;Liver_T22;Liver_N21;Liver_N20;Liver_T20;Liver_N19;Liver_N22;Liver_T17;Liver_N17;Liver_T19;Liver_N18;Liver_T18 | ||||||||
| Method for Estimation | Ribo-;poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_002023 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr8:141856358-141900868:- | ||||
| CircRNA type | n/a | Gene ID | ENSG00000169398.15 | ||||
| Gene Name | PTK2 | Detection pipeline | Find_circ | ||||
| Sample Type | colorectal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_104707 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr8:141856358-141900868:- | ||||
| CircRNA type | exonic | Gene ID | ENSG00000169398.15 | ||||
| Gene Name | PTK2 | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0003221/circPTK2 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr8:141856358-141900868:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000169398.15 | ||||
| Gene Name | PTK2 | Detection pipeline | N/A | ||||
| Sample Type | Bladder cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | ATCATACTGGGAGATGCGGG | ||||||||
| Reverse Primer | AGTTGGGGTCAAGGTAAGCA | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |