| Aliases | hsa_circ_0084021 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr8:38801306-38803739:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000147526.19 | ||||
| Gene Name | TACC1 | Detection pipeline | . | ||||
| Sample Type | Nhek; K562; Gm12878; Bj; Ag04450; A549; Sknshra | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_61009 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr8:38801306-38803739 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | BJ;A549;Liver_N14;Cortex;Heart;Liver_N11;Liver;GM12878;Liver_N12;SH-SY5Y_D2_exp1;Liver_N13;Temporal;AG04450;Occipital;Liver_T14;Liver_N15;Liver_T8;K562;NHEK;Parietal;Liver_N7;Liver_N3;Liver_N10;Cerebellum;Hs68;Liver_T22;Liver_N21;Liver_T20;Liver_N17;Liver_N19;Liver_N22;Liver_T17;Liver_T21 | ||||||||
| Method for Estimation | poly(A)-;Ribo-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_004180 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr8:38801306-38803739:+ | ||||
| CircRNA type | n/a | Gene ID | ENSG00000147526.19 | ||||
| Gene Name | TACC1 | Detection pipeline | Find_circ | ||||
| Sample Type | colorectal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_104597 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr8:38801306-38803739:+ | ||||
| CircRNA type | exonic | Gene ID | ENSG00000147526.19 | ||||
| Gene Name | TACC1 | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0084021 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr8:38801306-38803739:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000147526.19 | ||||
| Gene Name | TACC1 | Detection pipeline | N/A | ||||
| Sample Type | Colorectal cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | CAGCAAGATCACCGTGAGCATA | ||||||||
| Reverse Primer | CAGGGCATTGATAACAAAGCAA | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |