Aliases hsa_circ_0005927 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr8:42259305-42260979:+
CircRNA type . Gene ID ENSG00000078668.9
Gene Name VDAC3 Detection pipeline .
Sample Type Hs68_RNase; Hs68_control; Nhek; K562; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Sknshra
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases HSA_CIRCpedia_61112 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr8:42259305-42260979
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type SH-SY5Y_D2_exp1;Lung;Liver_T14;SH-SY5Y_D0_exp1;BJ;H9;Heart;Liver;Liver_N11;Liver_N15;Liver_N13;GM12878;Liver_N14;Cortex;Cerebellum;Liver_T10;K562;Liver_T13;Forebrain;Diencephalon;Liver_N6;Parietal;HeLa_S3;Stomach;Liver_N12;Temporal;Liver_T12;PA1;AG04450;Occipital;H1;Thyroid;Liver_N8;HUVEC;Liver_T8;NHEK;Hs68;Liver_T19;Liver_T17;Liver_N19;Liver_N18;Liver_T22;Liver_N17;Liver_T20;Liver_N20;Liver_N21
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases hsa_circRNA_104600 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr8:42259305-42260979:+
CircRNA type exonic Gene ID ENSG00000078668.9
Gene Name VDAC3 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases hsa_circ_0005927 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr8:42259305-42260979:+
CircRNA type N/A Gene ID ENSG00000078668.9
Gene Name VDAC3 Detection pipeline N/A
Sample Type Gastric cancer
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer TGAATTTGGAGGTTCTATCTACCAG
Reverse Primer CCTTCAATTTCCCACTCTTCTTT
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size