Aliases hsa_circ_0084615 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr8:62593526-62596747:-
CircRNA type . Gene ID ENSG00000185942.11
Gene Name NKAIN3 Detection pipeline .
Sample Type Nhek; K562; Huvec; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Sknshra; Mcf7
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_61447 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr8:62593526-62596747
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type SK_N_SH;GM12878;Liver_N3;Liver_T13;Liver_N15;Occipital;Liver_T12;HUVEC;Liver_N10;H9;H1;Liver_T11;HeLa_S3;PA1;Cortex;Liver_N12;NHEK;Liver_N8;Liver_T15;Diencephalon;Liver_N6;Liver_T7;SH-SY5Y_D2_exp1;Temporal;K562;SH-SY5Y_D4_exp1;SH-SY5Y_D8_exp2;Liver_T8;Liver_T6;AG04450;Lung;Liver_N14;BJ;Cerebellum;Stomach;Forebrain;SH-SY5Y_D0_exp1;Kidney;HepG2;SH-SY5Y_D0_exp2;Liver_N13;Liver_T14;Liver_T3;Liver;SH-SY5Y_D4_exp2;Parietal;A549;Liver_T10;Thyroid;Heart;Liver_N11;Liver_N7;Hs68;Liver_N20;Liver_N19;Liver_N22;Liver_N21;Liver_T18;Liver_T20;Liver_T21;Liver_N17;Liver_T17;Liver_T19;Liver_T22;Liver_N18
Method for Estimation poly(A)-;Ribo-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases hsa_circRNA_104634 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr8:62593526-62596747:-
CircRNA type exonic Gene ID ENSG00000185942.11
Gene Name NKAIN3 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases hsa_circRNA_104634/hsa_circ_0084615 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr8:62593526-62596747:-
CircRNA type N/A Gene ID ENSG00000185942.11
Gene Name NKAIN3 Detection pipeline N/A
Sample Type Thoracic Aortic Dissection
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer CCAGCAATGCAATCACCATAAAC
Reverse Primer GATGGTGATGGAGATTTTGATGTG
Pubmed 29137225
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size