| Aliases | hsa_circ_0084927 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr8:95676924-95677424:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000104413.11 | ||||
| Gene Name | ESRP1 | Detection pipeline | . | ||||
| Sample Type | Nhek; H1hesc; Mcf7 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_61839 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr8:95676924-95677424 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | H9;Liver_N13;Kidney;Liver_N10;Thyroid;PA1;Liver_N14;Stomach;Cerebellum;H1;NHEK;Liver_N17;Liver_N19 | ||||||||
| Method for Estimation | RNaseR;Ribo-;poly(A)- | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_001913 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr8:95676924-95677424:+ | ||||
| CircRNA type | n/a | Gene ID | ENSG00000104413.11 | ||||
| Gene Name | ESRP1 | Detection pipeline | Find_circ | ||||
| Sample Type | colorectal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_104651 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr8:95676924-95677424:+ | ||||
| CircRNA type | exonic | Gene ID | ENSG00000104413.11 | ||||
| Gene Name | ESRP1 | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circRNA_0084927 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr8:95676924-95677424:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000104413.11 | ||||
| Gene Name | ESRP1 | Detection pipeline | N/A | ||||
| Sample Type | Acne | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | GGCACAAACATCACATGGGG | ||||||||
| Reverse Primer | ATGGTAAACCTCGTGCCCTG | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |