Aliases hsa_circ_0006174 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr9:110064315-110068928:+
CircRNA type . Gene ID ENSG00000119318.8
Gene Name RAD23B Detection pipeline .
Sample Type Hs68_RNase; Hs68_control; Helas3; H1hesc; Gm12878; Ag04450; A549; Mcf7
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases HSA_CIRCpedia_62133 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr9:110064315-110068928
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Parietal;Temporal;HeLa_S3;Liver;Liver_T14;Liver_T3;K562;Cortex;A549;GM12878;Diencephalon;H1;Liver_N15;PA1;Liver_N7;BJ;Hs68;Liver_N18;Liver_N17
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases hsa_circRNA_104852 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr9:110064315-110068928:+
CircRNA type exonic Gene ID ENSG00000119318.8
Gene Name RAD23B Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases hsa_circ_0006174 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr9:110064315-110068928:+
CircRNA type N/A Gene ID ENSG00000119318.8
Gene Name RAD23B Detection pipeline N/A
Sample Type Colorectal cancer
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer CATCCATCACTCCAGCATCAG
Reverse Primer GGTCACCATAACCACCACAAAG
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size