| Aliases | hsa_circ_0088452 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr9:126345447-126641300:- | ||||
| CircRNA type | . | Gene ID | ENSG00000252985.1 | ||||
| Gene Name | RF00108 | Detection pipeline | . | ||||
| Sample Type | Hepg2; H1hesc; Bj; Ag04450; A549; Nhek; Sknshra | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_62685 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr9:126345447-126641300 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | AG04450;NHEK;Parietal;BJ;H9;Diencephalon;Cortex;H1;A549;Forebrain;Liver;Liver_N14;PA1;Occipital;Temporal;HeLa_S3;Liver_N15;K562;GM12878;Liver_N8;Liver_N6;Hs68;Liver_N17;Liver_N19;Liver_T19 | ||||||||
| Method for Estimation | poly(A)-;Ribo-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0088452 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr9:126345447-126641300:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000252985.1 | ||||
| Gene Name | RF00108 | Detection pipeline | N/A | ||||
| Sample Type | Active Pulmonary Tuberculosis | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | CTGGGATAGGCCACTTCAAC | ||||||||
| Reverse Primer | TCGTGATCCTGAATGTGGAC | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |