| Aliases | hsa_circ_0086376 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr9:14146687-14179779:- | ||||
| CircRNA type | . | Gene ID | ENSG00000147862.16 | ||||
| Gene Name | NFIB | Detection pipeline | . | ||||
| Sample Type | H1hesc; A549; Sknshra | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_63571 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr9:14146687-14179779 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Liver_N14;AG04450;H9;Parietal;Forebrain;Liver_N13;Liver_T6;Liver_N7;HUVEC;Liver_N12;Diencephalon;A549;SH-SY5Y_D2_exp1;SK_N_SH;Liver_N6;Thyroid;Liver_T15;Occipital;Liver;HepG2;SH-SY5Y_D0_exp1;Temporal;Liver_T8;Cortex;H1;Liver_N11;Liver_N3;Liver_N8;Heart;Stomach;Liver_T13;Liver_T11;Liver_N15;SH-SY5Y_D4_exp1;Lung;Liver_T14;NHEK;HeLa_S3;Cerebellum;Liver_T12;Liver_T3;Liver_N10;Hs68;Liver_N20;Liver_T21;Liver_T22;Liver_T18;Liver_N19;Liver_N18;Liver_T17;Liver_T19;Liver_T20;Liver_N22;Liver_N21;Liver_N17 | ||||||||
| Method for Estimation | Ribo-;poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_007368 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr9:14146687-14179779:- | ||||
| CircRNA type | n/a | Gene ID | ENSG00000147862.16 | ||||
| Gene Name | NFIB | Detection pipeline | Find_circ | ||||
| Sample Type | colorectal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | chr9:14146687-14179779 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr9:14146687-14179779:n/a | ||||
| CircRNA type | n/a | Gene ID | ENSG00000147862.10 | ||||
| Gene Name | NFIB | Detection pipeline | UROBORUS | ||||
| Sample Type | gliomas | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circRNA_0086376 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr9:14146687-14179779:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000147862.16 | ||||
| Gene Name | NFIB | Detection pipeline | N/A | ||||
| Sample Type | Acne | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | ACAGGAGACTTTTACCCCTCT | ||||||||
| Reverse Primer | TAACCTGGAGGATTCTTGGCAG | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |