Aliases hsa_circ_0008732 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr9:16727794-16738483:-
CircRNA type . Gene ID ENSG00000173068.17
Gene Name BNC2 Detection pipeline .
Sample Type Hs68_RNase; Hs68_control; Huvec; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Sknshra
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_63616 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr9:16727794-16738483
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Liver_N6;Thyroid;AG04450;HUVEC;Occipital;Parietal;Lung;Liver_T11;Heart;BJ;Liver_N11;Liver_N15;Kidney;Temporal;Liver_N12;HeLa_S3;Liver_T13;Diencephalon;Liver_N8;GM12878;Liver_N14;Liver_T7;Liver_N3;Stomach;Cerebellum;H9;Liver_N7;Liver_N10;Liver_T3;A549;SH-SY5Y_D8_exp2;Liver_T10;Liver_T14;Forebrain;Cortex;Liver_T6;SK_N_SH;SH-SY5Y_D4_exp1;H1;Liver_T8;Liver_T12;Liver_T15;Liver;Liver_N13;Hs68;Liver_N20;Liver_T20;Liver_N21;Liver_T21;Liver_N17;Liver_T22;Liver_T17;Liver_N22
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases circ_006785 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr9:16727794-16738483:-
CircRNA type n/a Gene ID ENSG00000173068.17
Gene Name BNC2 Detection pipeline Find_circ
Sample Type colorectal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25624062
Aliases hsa_circ_0008732 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr9:16727794-16738483:-
CircRNA type N/A Gene ID ENSG00000173068.17
Gene Name BNC2 Detection pipeline N/A
Sample Type Basal cell carcinoma
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer TTCGGAACCAGAACGACTACG
Reverse Primer TCTTGCTCACTAAGCCTGTCCTC
Pubmed 27097056
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size