| Aliases | hsa_circ_0003575 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr9:33271149-33278223:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000086065.9 | ||||
| Gene Name | CHMP5 | Detection pipeline | . | ||||
| Sample Type | Hs68_RNase; Hs68_control | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_63854 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr9:33271149-33278223 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Liver_N10;Liver_N3;Liver_T3;PA1;Liver_T7;SH-SY5Y_D2_exp1;A549;Liver_N12;SH-SY5Y_D0_exp1;SH-SY5Y_D4_exp1;Liver_N11;GM12878;Lung;SH-SY5Y_D4_exp2;Cerebellum;Parietal;Cortex;HepG2;SH-SY5Y_D8_exp2;Thyroid;Liver;Liver_N7;Liver_N8;Liver_N15;K562;Liver_T10;Liver_N13;Forebrain;Stomach;Liver_T11;Liver_T12;Liver_N14;Liver_N6;Diencephalon;Heart;Liver_T14;Occipital;Liver_T13;AG04450;Temporal;Hs68;Liver_N18;Liver_N21;Liver_T19;Liver_T20;Liver_N19;Liver_N17;Liver_T21;Liver_N20;Liver_T17;Liver_T18;Liver_N22;Liver_T22 | ||||||||
| Method for Estimation | Ribo-;poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0003575 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr9:33271149-33278223:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000086065.9 | ||||
| Gene Name | CHMP5 | Detection pipeline | N/A | ||||
| Sample Type | Atherosclerosis | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | CATCCGCTACCTCATCTCGT | ||||||||
| Reverse Primer | GTTGCTACCACCACTCCCATA | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |