Aliases hsa_circ_0001866 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr9:86293355-86297981:-
CircRNA type . Gene ID ENSG00000135018.9
Gene Name UBQLN1 Detection pipeline .
Sample Type cd_19; neutr; Hs68_RNase; Hs68_control; K562; H1hesc; Gm12878; Bj; Ag04450; A549; Nhek; Sknshra
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_64533 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr9:86293355-86297981
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Liver_N12;SH-SY5Y_D0_exp1;Cerebellum;K562;Liver_N14;PA1;Cortex;Liver_T12;Parietal;AG04450;Occipital;Liver_N7;Liver_T10;GM12878;HeLa_S3;Temporal;Liver;Liver_T13;Heart;Liver_T11;Liver_N8;H1;Liver_N10;Kidney;Diencephalon;Liver_T22;Liver_N15;NHEK;A549;BJ;Liver_N11;Lung;H9;Thyroid;HepG2;Liver_T14;Forebrain;SH-SY5Y_D2_exp1;Liver_N6;Hs68;Liver_N19;Liver_T17;Liver_N17;Liver_T21;Liver_T18;Liver_N18;Liver_T20;Liver_N20
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases hsa_circRNA_104807 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr9:86293355-86297981:-
CircRNA type exonic Gene ID ENSG00000135018.9
Gene Name UBQLN1 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases hsa_circ_104807/hsa_circ_0001866 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr9:86293355-86297981:-
CircRNA type N/A Gene ID ENSG00000135018.9
Gene Name UBQLN1 Detection pipeline N/A
Sample Type Systemic Lupus Erythematosus
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer CCAGCAATGATGCAGGAGATGA
Reverse Primer CCAAGGCCACCTAAACCAAAAG
Pubmed 29360436
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size