Aliases hsa_circ_0005218 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr9:96233422-96259881:+
CircRNA type . Gene ID ENSG00000207276.1
Gene Name RNU6-1160P Detection pipeline .
Sample Type Hs68_RNase; Hs68_control; K562; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Sknshra
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases HSA_CIRCpedia_64724 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr9:96233422-96259881
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Parietal;Lung;SH-SY5Y_D8_exp2;Liver_T13;A549;Liver_T11;PA1;Liver_N12;Liver_N13;Thyroid;BJ;Cerebellum;H1;Diencephalon;Liver;Occipital;Temporal;GM12878;AG04450;Liver_T12;Cortex;HeLa_S3;HepG2;Liver_T14;HUVEC;NHEK;Heart;K562;Stomach;Liver_N8;Hs68;Liver_T22;Liver_N18;Liver_N22;Liver_N21;Liver_N19;Liver_T21
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circ_002382 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr9:96233422-96259881:+
CircRNA type n/a Gene ID ENSG00000207276.1
Gene Name RNU6-1160P Detection pipeline Find_circ
Sample Type colorectal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases hsa_circRNA_104820 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr9:96233422-96259881:+
CircRNA type exonic Gene ID ENSG00000207276.1
Gene Name RNU6-1160P Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases hsa_circRNA_104820/circFAM120A/hsa_circ_0005218 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr9:96233422-96259881:+
CircRNA type N/A Gene ID ENSG00000207276.1
Gene Name RNU6-1160P Detection pipeline N/A
Sample Type Pre-Eclampsia (PE)
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer CCGTTGCTGACTATGTACGC
Reverse Primer TCATACGCAACCAAGCCATG
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size