| Aliases | chr9:96233422|96261168 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr9:96233422-96261168:n/a | ||||
| CircRNA type | n/a | Gene ID | ENSG00000048828.12 | ||||
| Gene Name | FAM120A | Detection pipeline | n/a | ||||
| Sample Type | Breast cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0001875 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr9:96233422-96261168:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000207276.1 | ||||
| Gene Name | RNU6-1160P | Detection pipeline | . | ||||
| Sample Type | neutr; Hs68_RNase; Hs68_control; K562; Huvec; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Nhek; Sknshra; Mcf7 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_64725 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr9:96233422-96261168 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Liver_T10;GM12878;Occipital;A549;Liver_T15;Diencephalon;Liver_N13;NHEK;PA1;Cerebellum;H1;HUVEC;Stomach;Liver_N10;Liver_T7;Liver_N3;Liver_T11;BJ;SH-SY5Y_D0_exp2;SH-SY5Y_D4_exp2;H9;Forebrain;Liver_N15;Liver_T14;Liver_T8;K562;HepG2;Heart;Liver_T12;Parietal;Kidney;SH-SY5Y_D2_exp1;Lung;Liver_T3;Temporal;Liver_N6;Liver_N11;Liver_N8;Thyroid;SH-SY5Y_D0_exp1;Liver_N7;AG04450;Liver_N12;SH-SY5Y_D4_exp1;Liver_T13;HeLa_S3;Liver;Cortex;Liver_N14;Liver_T6;Hs68;Liver_T18;Liver_N18;Liver_T21;Liver_N17;Liver_T17;Liver_T22;Liver_N19;Liver_T19;Liver_N22;Liver_N21;Liver_T20;Liver_N20 | ||||||||
| Method for Estimation | Ribo-;poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_003588 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr9:96233422-96261168:+ | ||||
| CircRNA type | n/a | Gene ID | ENSG00000207276.1 | ||||
| Gene Name | RNU6-1160P | Detection pipeline | Find_circ | ||||
| Sample Type | colorectal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | chr9:96233422-96261168 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr9:96233422-96261168:n/a | ||||
| CircRNA type | n/a | Gene ID | ENSG00000048828.12 | ||||
| Gene Name | FAM120A | Detection pipeline | UROBORUS | ||||
| Sample Type | gliomas | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_104821 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr9:96233422-96261168:+ | ||||
| CircRNA type | exonic | Gene ID | ENSG00000207276.1 | ||||
| Gene Name | RNU6-1160P | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_104821/hsa_circ_0001875 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr9:96233422-96261168:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000207276.1 | ||||
| Gene Name | RNU6-1160P | Detection pipeline | N/A | ||||
| Sample Type | breast cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | CCACCACATTACTTAGGTTGCA | ||||||||
| Reverse Primer | CGTTCCGGCTCAGTTTTAGG | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |