| Aliases | hsa_circ_0089974 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chrX:17705861-17710588:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000188158.15 | ||||
| Gene Name | NHS | Detection pipeline | . | ||||
| Sample Type | Hepg2; Helas3; H1hesc; Bj; A549; Nhek | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_65535 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chrX:17705861-17710588 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Cortex;HeLa_S3;A549;BJ;Temporal;Diencephalon;Cerebellum;Occipital;Liver_T10;Liver_T3;HepG2;PA1;H1;NHEK;Parietal;Hs68;Liver_T19;Liver_N20 | ||||||||
| Method for Estimation | Ribo-;poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_104983 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chrX:17705861-17710588:+ | ||||
| CircRNA type | exonic | Gene ID | ENSG00000188158.15 | ||||
| Gene Name | NHS | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_104983/hsa_circ_0089974 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chrX:17705861-17710588:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000188158.15 | ||||
| Gene Name | NHS | Detection pipeline | N/A | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | GGCGTGAGTTTAAGGACCGT | ||||||||
| Reverse Primer | GTGGCTGGGAGGAAGATGTT | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |