| Aliases | hsa_circ_0091017 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chrX:70601592-70607311:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000120498.13 | ||||
| Gene Name | TEX11 | Detection pipeline | . | ||||
| Sample Type | Hepg2; Gm12878; A549 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_66219 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chrX:70601592-70607311 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Liver_T14;PA1;HeLa_S3;Liver_N13;GM12878;HepG2;Cortex;Stomach;Thyroid;A549;Occipital;Liver_N15;BJ;Liver_T10;Forebrain;Liver_N12;Liver_N11;K562;AG04450;Liver;Temporal;Diencephalon;Cerebellum;Parietal;Hs68;Liver_N17;Liver_N19;Liver_N21 | ||||||||
| Method for Estimation | Ribo-;RNaseR;poly(A)- | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0091017 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chrX:70601592-70607311:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000120498.13 | ||||
| Gene Name | TEX11 | Detection pipeline | N/A | ||||
| Sample Type | Bladder cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | ATCATTCGGACAAGACAGG | ||||||||
| Reverse Primer | TCCATATACCAGATCCTCATTG | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |