Aliases HSA_CIRCpedia_154834 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chrX:71140634-71141964
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Hs68;Parietal;Temporal;Occipital;K562;BJ;Heart;Cortex;Diencephalon;Liver_N7;Liver_T3;Liver_T12;Liver_N11;Liver_T14;Liver_T18
Method for Estimation Ribo-
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circRNA_101308 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus n/an/a
CircRNA type n/a Gene ID NA
Gene Name NA Detection pipeline n/a
Sample Type Gastric cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circRNA_101308 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus N/A
CircRNA type N/A Gene ID NA
Gene Name NA Detection pipeline N/A
Sample Type Gastric cancer
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer CACCTCCATCGAACCCATCC
Reverse Primer CAAGCCAAATGCAATCATTAACAG
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size