| Aliases | circRNA.37134 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | n/a | ||||
| CircRNA type | exon | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | n/a | ||||
| Sample Type | gestational diabetes mellitus | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0092187 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chrY:257968-273067:- | ||||
| CircRNA type | . | Gene ID | ENSGR0000167393.12 | ||||
| Gene Name | PPP2R3B | Detection pipeline | . | ||||
| Sample Type | Hepg2 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circRNA.37134 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | N/A | ||||
| CircRNA type | N/A | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | N/A | ||||
| Sample Type | Gestational Diabetes Mellitus | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | CCATGTCAGAGCTCCCATCT | ||||||||
| Reverse Primer | TTCTCGACCTGTCTGCCTTT | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |