Aliases circRNA.20159 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus n/a
CircRNA type exon Gene ID NA
Gene Name NA Detection pipeline n/a
Sample Type gestational diabetes mellitus
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases HSA_CIRCpedia_126123 Scientific name Homo sapiens (hg38)
Organism Human Genome Locus chrY:26328945-26348578
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type PA1;Liver_N11
Method for Estimation Ribo-
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases circRNA.20159 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus N/A
CircRNA type N/A Gene ID NA
Gene Name NA Detection pipeline N/A
Sample Type Gestational Diabetes Mellitus
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer GCTGGCTACAGCAAACATCA
Reverse Primer TGTCCTCCATGCTGTCAGAG
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size