| Aliases | hsa_circRNA_102619 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | N/A | ||||
| CircRNA type | N/A | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | N/A | ||||
| Sample Type | Pancreatic Ductal Adenocarcinoma | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | GGGCATCTATTACATTCCATTCT | ||||||||
| Reverse Primer | ATTATTCTCCGCAGCATCAGT | ||||||||