Aliases | Hsa-circRNA11783-2 | Scientific name | Homo sapiens (hg19) | ||||
Organism | Human | Genome Locus | N/A | ||||
CircRNA type | N/A | Gene ID | NA | ||||
Gene Name | NA | Detection pipeline | N/A |
Sample Type | Coronary artery disease and type 2 Diabetes mellitus | ||||||||
Method for Estimation | Microarray and Quantitative PCR | ||||||||
Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
Primers (Experimented) | |||||||||
Primers (Validated) | |||||||||
Forward Primer | GGCTTCTGGGACGTCTAAACA | ||||||||
Reverse Primer | TGCAGCTGTAAAGCACTCTTTC |