Aliases hsa_circ_0023642 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr11:75727858-75728024:+
CircRNA type . Gene ID ENSG00000198382.4
Gene Name UVRAG Detection pipeline .
Sample Type K562; Huvec
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases HSA_CIRCpedia_5646 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr11:75727858-75728024
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Heart;PA1;HUVEC;Cortex;K562;Parietal;Hs68
Method for Estimation Ribo-;RNaseR;poly(A)-
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases hsa_circRNA_100888 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr11:75727858-75728024:+
CircRNA type exonic Gene ID ENSG00000198382.4
Gene Name UVRAG Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases hsa_circ_0023642 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr11:75727858-75728024:+
CircRNA type N/A Gene ID ENSG00000198382.4
Gene Name UVRAG Detection pipeline N/A
Sample Type Gastric cancer
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer ATGACAAACTGACGGAAAAGGAG
Reverse Primer AACCAAGGGCAACAGCAATG
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size