Aliases hsa_circ_0000267 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr10:126370175-126370948:-
CircRNA type . Gene ID ENSG00000189319.9;ENSG00000258539.1
Gene Name FAM53B;RP11-12J10.3 Detection pipeline .
Sample Type cd_19; Hs68_RNase; Hs68_control; Nhek; K562; Huvec; Hsmm; Hmec; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Sknshra; Mcf7
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_826 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr10:126370175-126370948
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Liver_T3;NHEK;PA1;Liver_T10;Liver_N14;Liver_T13;Forebrain;Liver_N6;Cerebellum;Liver_N12;Liver_T6;HepG2;Liver_N11;Temporal;Liver_N3;HUVEC;A549;Stomach;H9;SH-SY5Y_D2_exp1;Cortex;K562;Liver_T15;SH-SY5Y_D0_exp2;SH-SY5Y_D4_exp2;Liver;HeLa_S3;Thyroid;Liver_N8;Liver_T12;BJ;Lung;H1;GM12878;SH-SY5Y_D0_exp1;AG04450;Liver_T14;Liver_N7;SH-SY5Y_D4_exp1;Liver_T8;Parietal;Diencephalon;Liver_N13;Heart;Liver_T11;Liver_N10;Liver_N15;Occipital;Liver_T7;Hs68;Liver_T17;Liver_N18;Liver_N20;Liver_T20;Liver_N19;Liver_N21;Liver_N22;Liver_N17;Liver_T19;Liver_T21
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases circ_008916 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr10:126370175-126370948:-
CircRNA type n/a Gene ID ENSG00000189319.9;ENSG00000258539.1
Gene Name FAM53B;RP11-12J10.3 Detection pipeline Find_circ
Sample Type colorectal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25624062
Aliases chr10:126370175-126370948 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr10:126370175-126370948:n/a
CircRNA type n/a Gene ID ENSG00000189319.9;ENSG00000258539.1
Gene Name FAM53B;RP11-12J10.3 Detection pipeline UROBORUS
Sample Type gliomas
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 26873924
Aliases hsa_circRNA_100708 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr10:126370175-126370948:-
CircRNA type exonic Gene ID ENSG00000189319.9;ENSG00000258539.1
Gene Name FAM53B;RP11-12J10.3 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases hsa_circ_0000267 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr10:126370175-126370948:-
CircRNA type N/A Gene ID ENSG00000189319.9;ENSG00000258539.1
Gene Name FAM53B;RP11-12J10.3 Detection pipeline N/A
Sample Type Liver cell carcinoma
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer AACGACAAGAAGGTCGGTGT
Reverse Primer TTTTCAGGCAGGCATTCCCA
Pubmed 30018710
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size