Aliases hsa_circ_0003570 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr10:126370175-126384781:-
CircRNA type . Gene ID ENSG00000189319.9;ENSG00000258539.1
Gene Name FAM53B;RP11-12J10.3 Detection pipeline .
Sample Type Hs68_RNase; Hs68_control; Nhek; K562; Hsmm; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Sknshra
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_827 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr10:126370175-126384781
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type NHEK;H1;AG04450;K562;PA1;HepG2;SK_N_SH;Liver_T3;Lung;Forebrain;Liver_N6;HeLa_S3;Liver_N8;Stomach;H9;Thyroid;Temporal;Liver_N11;Liver_N15;SH-SY5Y_D0_exp1;A549;Liver_T6;Cerebellum;Parietal;Diencephalon;SH-SY5Y_D8_exp2;GM12878;Liver_N10;Liver_T8;Cortex;Heart;BJ;Occipital;Hs68;Liver_N17;Liver_T17;Liver_N19;Liver_N21
Method for Estimation poly(A)-;RNaseR;Ribo-
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases circ_008017 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr10:126370175-126384781:-
CircRNA type n/a Gene ID ENSG00000189319.9;ENSG00000258539.1
Gene Name FAM53B;RP11-12J10.3 Detection pipeline Find_circ
Sample Type colorectal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25624062
Aliases hsa_circRNA_100709 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr10:126370175-126384781:-
CircRNA type exonic Gene ID ENSG00000189319.9;ENSG00000258539.1
Gene Name FAM53B;RP11-12J10.3 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases hsa_circ_0003570 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr10:126370175-126384781:-
CircRNA type N/A Gene ID ENSG00000189319.9;ENSG00000258539.1
Gene Name FAM53B;RP11-12J10.3 Detection pipeline N/A
Sample Type Liver cell carcinoma
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer CAAGATGGCACAGCAGCACACGC
Reverse Primer ATGCTGGTGCTCGGTTGGTC
Pubmed 28493512
Aliases hsa_circRNA_100709/hsa_circ_0003570 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr10:126370175-126384781:-
CircRNA type N/A Gene ID ENSG00000189319.9;ENSG00000258539.1
Gene Name FAM53B;RP11-12J10.3 Detection pipeline N/A
Sample Type Infantile Hemangioma (IH)
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer AAGATGGCACAGCACACGC
Reverse Primer CTGTCATTTTCCATAATTCCACA
Pubmed 29095957
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size