| Aliases | hsa_circ_0023956 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr11:86017286-86017524:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000073921.17 | ||||
| Gene Name | PICALM | Detection pipeline | . | ||||
| Sample Type | K562; Huvec; Hepg2; H1hesc; Gm12878; Bj; Ag04450; Nhek; Sknshra | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_5920 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr11:86017286-86017524 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | GM12878;Cortex;Liver_T8;Liver_N3;Liver_T14;SH-SY5Y_D2_exp1;NHEK;SH-SY5Y_D0_exp1;SH-SY5Y_D0_exp2;Liver_T3;Cerebellum;Liver_N11;Forebrain;PA1;Stomach;Liver_T15;Lung;H9;Parietal;Liver;AG04450;K562;Heart;HUVEC;HepG2;Temporal;Liver_N7;Liver_T7;Liver_N6;Liver_N14;H1;Liver_T10;Liver_N15;Liver_N8;Diencephalon;Occipital;Hs68;Liver_N18;Liver_T18;Liver_N21;Liver_T22;Liver_N19;Liver_N20 | ||||||||
| Method for Estimation | poly(A)-;Ribo-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0023956 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr11:86017286-86017524:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000073921.17 | ||||
| Gene Name | PICALM | Detection pipeline | N/A | ||||
| Sample Type | Active Pulmonary Tuberculosis | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | GAATGGGAGGATCTGTCTAC | ||||||||
| Reverse Primer | TTATCCTCTGCCACTTGCT | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |